| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis | The 119 base pair (bp) double-stranded DNA (dsDNA) fragments were designed as shown in Figure 1 (5'-CTCGAGGCAGGATCACCGTGCAGGAGGCGA CGGCTCGCATCGCTGACCTGGTCACCGGATCCCC AACCTTGGTCAGTCATGACCCACGAGCGTTAGAA GCAGGACTGTCTCGCCATATG-3'; restriction sites are underlined; C: cytosine, T: thymine, G: guanine and A: adenine) and synthesized by GenScript. The two restriction sites XhoI and NdeI were used to clone the synthetic DNA fragment into the same sites of the vector pCAP03-acc(3)IV7yielding the capture vector pJB005EL. Prior to direct TAR cloning, the capture vector was digested with BamHI. | Get A Quote |
Genome mining provides exciting opportunities for the discovery of natural products. However, in contrast to traditional bioassay-guided approaches, challenges of genome mining include poor or no expression of biosynthetic gene clusters (BGCs). Additionally, given that thousands of BGCs are now available through extensive genome sequencing, how does one select BGCs for discovery? Synthetic biology techniques can be used for BGC refactoring and activation, whereas resistance-gene-directed genome mining is a promising approach to discover bioactive natural products. Here we report the selection of a BGC by applying a resistance-gene-directed approach, cloning of the silent BGC from Micromonospora sp. B006, prom... More
