| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis | The primers used are F: GGTGCCAAAAAGGTGGTCAT and R: CAACAACGAACATGGGAGCAT. The following procedure was used on a ViiA™7 System (Applied Biosystems, Foster City, CA, USA): initial denaturation at 95 °C for 10 min followed by 45 cycles of 95 °C for 15 s, 60 °C annealing and extension for 60 s. After the reactions, a dissociation curve analysis was conducted to evaluate the primer specificity. The amplification results were analysed using the comparative cycle threshold (Ct) method, which uses the formula 2−ΔΔCT (Livak and Schmittgen, 2001). All reactions were performed in triplicate per experiment on 96-well PCR plates. The qRT-PCR results were calculated as the means of three replicated treatments. Significant differences between treatments were evaluated by their standard deviation. All primers were synthesized by GenScript (Nanjing) Biotechnology Co., Ltd., Nanjing, China. | Get A Quote |
Ginkgo biloba breeding commonly concentrates on the selection of superior trees that have high flavonoid contents. The flavonoids present in Ginkgo leaves have strong medicinal implications, including anti-dengue, anti-HIV, anticancer, antioxidant and anti-inflammatory properties. Flavonoids play important roles in plant immune responses; however, the molecular mechanisms underlying these interesting responses remain unclear. To obtain a comprehensive understanding, we performed the transcriptome sequencing of Ginkgo with different flavonoid contents. Using an Illumina sequencing platform, we obtained approximately 533,952,528 clean reads. After the sequences were filtered and assembled, the transcriptome ... More
