Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | (TATTTACAGGACGCTCTGAT) was designed using the Cas designer tool from the Center for Genome Engineering, Institute for Basic Science, Korea (http://www.rgenome.net) in order to avoid off-target effects. The gRNA cassette was synthesized by Life Technologies. The editing template, consisting of two 1 kb regions flanking the dhaB gene, was synthesized by GenScript (USA) according to C. pasteurianum DSM 525 genomic DNA sequence. gRNA and editing template were inserted in pMTL85141-Cas9n to form pMTL85141-Cas9n-dhaB. | Get A Quote |
Clostridium pasteurianum produces industrially valuable chemicals such as n-butanol and 1,3-propanediol from fermentations of glycerol and glucose. Metabolic engineering for increased yields of selective compounds is not well established in this microorganism. In order to study carbon fluxes and to selectively increase butanol yields, we integrated the latest advances in genome editing to obtain an electrocompetent Clostridium pasteurianum strain for further engineering. Deletion of the glycerol dehydratase large subunit (dhaB) using an adapted S. pyogenes Type II CRISPR/Cas9 nickase system resulted in a 1,3-propanediol-deficient mutant producing butanol as the main product. Surprisingly, the mutant was able to... More