Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | PCR primers were obtained from Genscript (Nanjing, Jiangsu, China) and the primer set designed for the cereulide synthetase gene (cesB) of emetic B.cereus are listed in Table 1. The ssDNA (88 nt) was synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and the sequences (5ʹ → 3ʹ) was as follows: TAACGGACCATTTGCGAGATTGTATACTCTTTTAGACTCTTTTAACATAAGTTCATCTACTTCTTCTATCCGTAATCCTTCTGGCATC. | Get A Quote |
Bacillus cereus is a causative agent of an emetic food-borne disease. In this study, visual detection of viable emetic B. cereus was developed using a propidium monoazide (PMA)-asymmetric polymerase chain reaction (asPCR) and unmodified gold nanoparticles (AuNPs). To detect only the viable emetic B. cereus, PMA treatment was selected before DNA extraction to eliminate the false-positive results from dead bacteria. In the presence of viable target bacteria, the long genomic DNA fragments from the cereulide synthetase gene (cesB) were produced by asPCR, which could be effectively absorbed onto naked AuNPs via coordination between Au and the nitrogen atoms of the exposed bases. After adding NaCl solution, visu... More