| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis | The gene encoding the Sb-T6PP protein was amplified by PCR using DNA synthesized by GenScript, Deep Vent DNA polymerase, along with a gene-specific oligonucleotide forward primer (5′CCTCGCGAATGCATCTAGATCCCAT3′) and reverse primer (5′CAGGCCTCTGCAGTCGACGG3′) containing NdeI and XhoI restriction sites, respectively. The pET-28a vector, digested by NdeI and XhoI restriction enzymes, was ligated to the PCR product previously digested with the same restriction enzymes. The ligation product was used to transform T7 Express IqCompetent E. coli cells (High Efficiency) that were then grown on an agar plate containing ampicillin. A selected colony was checked for Sb-T6PP expression and the isolated plasmid was sequenced to verify the correct gene sequence. Sb-T6PP was further prepared using the same method described for Mt-T6PP preparation. | Get A Quote |
In this study, trehalose 6-phosphate phosphatase (T6PP) was targeted for inhibitor development. T6PP catalyzes the hydrolysis of trehalose-6-phosphate to form trehalose and inorganic phosphate, a reaction essential to important fungal, bacterial, and nematodal pathogens. At the current time, there are no specific inhibitors of T6PP available to serve as tools for interrogating its structure and function nor as leads for pharmaceutical applications. Herein, we describe the synthesis of non-hydrolysable mimics of trehalose-6-phosphate, which incorporate 6-sulfate (1), -phosphonate (2), -fluorophosphonate (3) and –boronate (4) groups in place of the 6-phosphate moiety of the substrate. The inhibitory efficacies ... More
