Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | 2 inner/outer primer F: GTGACAACAATGATTAGAC CCCTG Synthesized by GenScript N/A VH186....2 outer primer R: AGCTGTATCATGCTCTTCTTGGCA Synthesized by GenScript N/A (Continued on next page) e2 Cell Reports 25, 3393–3404. | Get A Quote |
Antibody affinity maturation, which is an antigen-based selection process for B cells, occurs in germinal centers (GCs). GCB cells must efficiently recognize, acquire, and present antigens from follicular dendritic cells (FDCs) to receive positive selection signals from T helper cells. Previous studies showed that GCB cells undergo adhesive interactions with FDCs, but the regulatory mechanisms underlying the cell adhesions and their functional relevance remain unclear. Here, we identified H3K36me2 methyltransferase Nsd2 as a critical regulator of GCB cell-FDC adhesion. Nsd2 deletion modestly reduced GC responses but strongly impaired B cell affinity maturation. Mechanistically, Nsd2 directly regulated expressio... More