Products/Services Used | Details | Operation |
---|---|---|
Custom Vector Construction> | … Eventually, we obtained the overexpression vector, pIZ-BmPP2A-FLAG. Next we synthesized the miRNA (GenScript, Nanjing, China) (siRNA sequence targeting BmPP2A: AGGCGCGCCCGGCGTAGTAATCAGCGGAGACGTCAATTTCTTTCGATCTGCTACT … | Get A Quote |
Ser/Thr protein phosphatase 2A (PP2A) is one of the type 2 protein phosphatases, which is required for many intracellular physiological processes and pathogen infection. However, the function of PP2A is unclear in silkworm, Bombyx mori. Here, we cloned and identified BmPP2A, a PP2A gene from B. mori, which has two HEAT domains and a high similarity to PP2A from other organisms. Our results showed that BmPP2A is localized in the cytoplasm and highly expressed in silkworm epidermis and midgut, and that Bombyx mori nucleopolyhedrovirus (BmNPV) infection induces down-regulation of BmPP2A expression. Furthermore, up-regulation of BmPP2A via overexpression significantly inhibited BmNPV multiplication.... More