Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | … custom synthesized by Invitrogen Corp. (Carlsbad, CA). The TaqMan probe, sk104-213 (5′ TGGGAC GATATAGTGATACCAGTTGCCC 3′), was custom synthesized by GenScript Corp. (Scotch Plains, NJ) and was labeled … | Get A Quote |
Spiroplasma kunkelii, a cell wall-less bacterium, is the causal agent of corn stunt disease. The pathogen is restricted to phloem sieve cells of infected plants and is transmitted by phloem-feeding leafhoppers. Since symptoms of corn stunt disease may not appear until close to flowering time, early detection of the pathogen in disease-transmitting leafhoppers and in symptomless foliar tissues of host plants is critical to disease forecasting and outbreak management. In this study, a field-deployable real-time polymerase chain reaction (PCR) assay was developed for sensitive and specific detection of S. kunkelii. Nucleotide sequence from a previously unreported adhesin-like gene was used to design primer... More