Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | ... (2009) and VRTN g. 20311_20312ins291 (F:GGCAGGGAAGGTGTTTGTTA;R:GACTGGCCTCTG TCCCTTG) mutations from Fan et al. (2013) were synthesized by Nanjing Genscript Biological Engi- neering Technology Company (China). ... | Get A Quote |
Variation of the vertebral number is associated with carcass traits in pigs. However, results from different populations do not match well with others, especially for carcass weight. Therefore, effects of increased vertebral number on carcass weight were investigated by analyzing the relationship between two loci multi-vertebra causal loci (NR6A1 g.748 C > T and VRTN g.20311_20312ins291) and carcass weight in PIC pigs. Results from the association study between vertebral number and carcass weight showed that increased thoracic number had negative effects on carcass weight, but the results were not statistically significant. Further, VRTN Ins/Ins genotype increased more than one thoracic than that of Wt/Wt genot... More