Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | ... The optimum sequences of the Primers were chosen after they were analyzed by the software Primer 5.0 and synthes- ized by Nanjing Genscript Corporation as the following se- quences: 18S rDNA F 5′AATGGCTCGGTAAATCAGTT3′ R 5′AGTTGATGACTCGCGCTTAC3 ... | Get A Quote |
Green macroalgae Chaetomorpha aerea and C. linum are taxonomically confused. In this paper, we tried morphological and molecular analyses to separate these two species. C. aerea and C. linum can be distinguished from morphological characteritics, such as frond dimension, cells size and shape, their mean length/width ratios(LWR), and cell walls constriction. Thalli of C. aerea attenuate basipetally, with diameter 270–500 μm at upper portion, 160–360 μm at middle portion, 100–160 μm at basal portion. For the upper part, the length of cells is less than their diameter. Cell walls usually constrict at the dissepiments, which are pellucid or colorless and give the filament beaded appearance. In contrast, th... More