Human HEK3-F validation primer
Forward primer (Desalt grade) used for the validation of prime editing against human HEK3 gene. [Reference] Nelson, et al. Nat Biotechnology, 2022; 40: 402-410.
| ￥30 | |
| KIOK19 | |
|
|
|
|
|
|
|
|
|
| ￥30 | |
| KIOK19 | |
|
|
|
|
|
|
|
|
|
| Description |
Forward primer used for the validation of prime editing against human HEK3 gene. [Reference] Nelson, et al. Nat Biotechnology, 2022; 40: 402-410. |
||||||
| Sequence |
TCTCTGACCACTGCGATATG |
||||||
| Quantity | 0.5nmol | ||||||
| Storage Condition | Stable for at least 24 months at -20°C. Avoid repeated freeze-thaw cycles. | ||||||
| Quality Specifications |
|
